Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb3bbx1B.i2001-2022 | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 3bbx:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||
Source: Information | THE HSP15 PROTEIN FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF THE 50S.NC-TRNA.HSP15 COMPLEX | ||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 0.00 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||
Position | (2001, 2022) | ||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CUAAGGUAGCGAAAUUCCUU_ | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
6: C2'-endo, 7: C4'-exo, 13: C2'-endo, 14: C2'-endo, 15: C2'-endo, 16: C3'-exo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
6: syn, 17: syn, 20: syn | ||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |