Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb3bbx1B.i1069-1092 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 3bbx:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | THE HSP15 PROTEIN FITTED INTO THE LOW RESOLUTION CRYO-EM MAP OF THE 50S.NC-TRNA.HSP15 COMPLEX | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 0.00 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (1069, 1092) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _AAAGUCAUGGUUAAGUGGGAAA_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
2: C2'-endo, 3: C4'-exo, 5: C2'-endo, 6: C2'-endo, 14: C2'-endo, 16: C2'-endo, 19: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: syn, 16: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |