Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2zjq1X.i930-953 | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2zjq:X (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | INTERACTION OF L7 WITH L11 INDUCED BY MICROCCOCIN BINDING TO THE DEINOCOCCUS RADIODURANS 50S SUBUNIT | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | RIBOSOMAL 23S RNA | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.30 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||
Position | (930, 953) | ||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UAAAUGAUCGCUCAGUGGUUAA_ | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
6: C2'-exo, 7: C4'-exo, 16: C4'-exo, 17: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |