Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2zjp1X.i930-953 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2zjp:X (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | THIOPEPTIDE ANTIBIOTIC NOSIHEPTIDE BOUND TO THE LARGE RIBOSOMAL SUBUNIT OF DEINOCOCCUS RADIODURANS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | RIBOSOMAL 23S RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.70 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (930, 953) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UAAAUGAUCGCUCAGUGGUUAA_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
2: C2'-exo, 3: C2'-exo, 6: C2'-exo, 16: C4'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
15: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |