Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2vhp1A.i742-765 | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhp:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 4 OF 4) | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||
Position | (742, 765) | ||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _AGACUGACGCUCAGGUGCGAAA_ | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
2: C2'-exo, 3: C1'-endo, 4: C4'-exo, 7: C2'-endo, 8: C2'-endo, 9: C2'-exo, 10: C2'-exo, 11: C4'-exo, 12: C2'-exo, 14: C2'-exo, 16: C2'-exo, 22: C2'-exo, 23: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
9: syn, 20: syn | ||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |