Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
| '20-Segment pdb2vhp1A.i36-57 | |||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source: [PDB-id:chain] | 2vhp:A (&rarr PDB) | ||||||||||||||||||||||||||||||||
| Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 4 OF 4) | ||||||||||||||||||||||||||||||||
| Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||
| Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||
| Position | (36, 57) | ||||||||||||||||||||||||||||||||
| Primary structure ('_': anchors) | _GGCAGGCCUAACACAUGCAA_ | ||||||||||||||||||||||||||||||||
|
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C4'-exo, 2: C4'-exo, 6: C2'-exo, 7: C2'-exo, 8: C3'-exo, 9: C1'-exo, 10: C3'-exo, 11: C3'-exo, 13: C2'-exo, 14: C2'-exo, 15: C2'-exo, 16: C2'-exo, 17: C2'-exo, 18: C2'-exo, 20: C1'-endo, 21: C1'-exo, 22: C2'-exo | ||||||||||||||||||||||||||||||||
|
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||
| Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||
|
Tertiary structure: Base-pairs (anchor pairs) |
None | ||||||||||||||||||||||||||||||||
| Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||
| 3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||
| Structural Clusters | |||||||||||||||||||||||||||||||||