Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'25-Hairpin pdb2vhp1A.e678-704 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhp:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 4 OF 4) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (678, 704) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _GUGUAGCGGUGAAAUGCGUAGAGAU_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C2'-exo, 2: C4'-exo, 5: C3'-exo, 6: C2'-endo, 7: C2'-exo, 8: C2'-exo, 12: C2'-exo, 14: C2'-exo, 15: C2'-exo, 19: C2'-exo, 20: C2'-endo, 21: C2'-endo, 22: C3'-exo, 24: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: syn, 6: syn, 20: syn, 22: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |