Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'14-18-3-2-4-3-21-3-Multiloop pdb2vho1A.m41-392
Source: [PDB-id:chain] 2vho:A (&rarr PDB)
Source: Information STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 3 OF 4)
Source: Compound 16S RIBOSOMAL RNA
Source: Resolution 3.74 ANGSTROMS.
Position (42, 391), (57, 102), (121, 232), (236, 282), (285, 307), (312, 333), (337, 344), (366, 387)
Primary structure ('_': anchors) _CCUAACACAUGCAA_-_GGACGGGUGAGUAAUGUC_-_GAU_-_UA_-_CACA_-_ACU_-_AGGCAGCAGUGGGGAAUAUUG_-_CAG_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		1: C2'-exo, 2: C3'-exo, 3: C1'-exo, 4: C3'-exo, 5: C3'-exo, 6: C2'-exo, 7: C2'-exo, 9: C2'-exo, 10: C2'-exo, 11: C2'-exo, 12: C2'-exo, 14: C1'-endo, 15: C1'-exo, 16: C2'-exo, 19: C2'-exo, 20: C2'-endo, 26: C2'-endo, 27: C2'-exo, 30: C3'-exo, 31: C2'-exo, 33: C2'-exo, 35: C2'-exo, 39: C2'-exo, 40: C2'-exo, 41: C1'-endo, 47: C2'-exo, 50: C3'-exo, 54: C2'-exo, 56: C2'-exo, 57: C2'-exo, 58: C2'-exo, 59: C1'-endo, 60: C3'-exo, 61: C2'-exo, 63: C2'-exo, 64: C2'-exo, 65: C4'-exo, 66: C2'-exo, 67: C4'-exo, 72: C2'-exo, 74: C4'-exo, 75: C2'-endo, 76: C2'-endo, 77: O4'-endo, 78: C2'-exo, 80: C4'-exo, 82: C4'-exo, 84: C2'-exo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		19: syn, 20: syn, 30: syn, 50: syn, 60: syn, 62: syn, 74: syn, 77: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 75 ↑
2 4 73 ↓
3 7 8 ↑
4 8 68 →
5 9 61 &larr
6 10 11 ↑
7 12 13 ↑
8 14 63 →
9 16 18 →
10 22 23 ↑
11 23 24 ↑
12 24 25 ↑
13 26 45 ↑
14 27 28 ↑
15 28 29 ↑
16 29 44 &larr
17 30 41 ↑
18 30 44 →
19 33 34 ↑
20 37 38 ↑
21 38 39 ↑
22 42 43 ↑
23 43 44 ↑
24 46 47 ↑
25 48 49 ↑
26 51 60 ↓
27 52 53 ↑
28 53 54 ↑
29 55 56 ↑
30 57 58 ↑
31 58 59 ↑
32 59 60 ↑
33 63 64 ↑
34 65 66 ↑
35 68 69 ↑
36 69 70 ↑
37 70 71 ↑
38 72 73 ↑
39 78 79 ↑
40 78 82 →
41 80 81 ↑
42 83 84 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 84 Watson-Crick/Watson-Crick cis y
2 2 70 Watson-Crick/Watson-Crick cis
3 4 70 Bifurcated/O2' ?
4 4 71 Sugar/Watson-Crick cis
5 4 74 Watson-Crick/Hoogsteen trans y
6 5 70 O2'/Hoogsteen ?
7 6 49 O2'/Watson-Crick ?
8 7 68 Watson-Crick/Watson-Crick cis y
9 9 60 Bifurcated/O2' ?
10 10 61 Bifurcated/O2' ?
11 10 66 O2'/Bifurcated ?
12 12 65 Watson-Crick/Watson-Crick cis y
13 13 63 Watson-Crick/Watson-Crick cis
14 15 18 O2'/Watson-Crick trans
15 16 17 Watson-Crick/Watson-Crick cis
16 19 21 Bifurcated/O2' ?
17 24 62 O2'/Sugar ?
18 25 49 Watson-Crick/Watson-Crick cis y
19 26 47 Watson-Crick/Watson-Crick cis y
20 27 48 O2'/Watson-Crick ?
21 30 43 Watson-Crick/Hoogsteen trans
22 30 44 Bifurcated/O2' ?
23 31 40 Watson-Crick/Hoogsteen trans y
24 34 39 Watson-Crick/Watson-Crick cis y
25 36 37 Watson-Crick/Watson-Crick cis y
26 41 42 Watson-Crick/Watson-Crick cis
27 45 46 Watson-Crick/Watson-Crick cis y
28 51 52 Watson-Crick/Watson-Crick cis
29 53 60 Watson-Crick/Watson-Crick cis
30 54 59 Watson-Crick/Watson-Crick cis y
31 56 57 Watson-Crick/Watson-Crick cis
32 65 77 O2'/Sugar ?
33 71 72 Hoogsteen/O2' ?
34 71 73 O2'/Hoogsteen ?
35 79 80 Watson-Crick/Watson-Crick cis
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters