Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'2-2-1-21-8-14-24-13-Multiloop pdb2vhn1B.m2055-2385
Source: [PDB-id:chain] 2vhn:B (&rarr PDB)
Source: Information STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME. (PART 2 OF 4)
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 3.74 ANGSTROMS.
Position (2058, 2382), (2061, 2190), (2193, 2205), (2207, 2227), (2249, 2261), (2270, 2279), (2294, 2317), (2342, 2368)
Primary structure ('_': anchors) _UU_-_UU_-_U_-_AGCACGAAGGUUGGCUAAUCC_-_GGAGGUUA_-_AUAAGCCAGCUUGA_-_GUGCGAAAGCAGGUCAUAGUGAUC_-_CUCAACGGAUAAA_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		8: C2'-exo, 9: C3'-exo, 12: C2'-exo, 13: C2'-exo, 14: O4'-endo, 16: C2'-exo, 17: C2'-exo, 18: O4'-exo, 19: C2'-endo, 20: C2'-endo, 21: C2'-exo, 28: C4'-exo, 32: C2'-exo, 34: C2'-exo, 37: C2'-exo, 40: C3'-exo, 41: C2'-exo, 42: C4'-exo, 43: C2'-exo, 46: C1'-exo, 47: C3'-exo, 49: O4'-endo, 51: C2'-exo, 53: C4'-exo, 55: C2'-exo, 56: C2'-exo, 57: C4'-endo, 58: C3'-exo, 59: C3'-exo, 63: C2'-exo, 69: C2'-exo, 73: O4'-endo, 74: C2'-exo, 75: C2'-endo, 76: C2'-exo, 79: C4'-exo, 82: C2'-endo, 83: C2'-exo, 84: C2'-exo, 87: C2'-exo, 88: C2'-exo, 89: C3'-exo, 90: C4'-exo, 91: C2'-endo, 92: C3'-exo, 96: C4'-exo, 97: C2'-exo, 98: C2'-exo, 99: C4'-exo, 100: C1'-endo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		3: syn, 14: syn, 18: syn, 19: syn, 20: syn, 40: syn, 41: syn, 42: syn, 49: syn, 57: syn, 95: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 4 101 →
3 6 7 ↑
4 8 92 →
5 12 13 ↑
6 15 16 ↑
7 15 80 ↓
8 19 21 →
9 21 22 ↑
10 22 23 ↑
11 24 25 ↑
12 25 26 ↑
13 25 53 →
14 26 27 ↑
15 28 46 ↑
16 31 32 ↑
17 33 34 ↑
18 35 36 ↑
19 36 37 ↑
20 37 38 ↑
21 38 39 ↑
22 39 40 ↑
23 43 44 ↑
24 46 48 →
25 48 50 ↑
26 50 51 ↑
27 53 54 ↑
28 54 55 ↑
29 58 60 →
30 58 72 &larr
31 59 74 →
32 61 62 ↑
33 64 65 ↑
34 64 72 →
35 65 66 ↑
36 67 68 ↑
37 68 69 ↑
38 70 71 ↑
39 71 72 ↑
40 77 78 ↑
41 82 90 &larr
42 83 84 ↑
43 83 95 ↓
44 84 85 ↑
45 85 86 ↑
46 88 90 ↑
47 98 99 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 101 Watson-Crick/Watson-Crick cis y
2 2 4 Hoogsteen/Watson-Crick cis y
3 4 5 Watson-Crick/Watson-Crick cis
4 4 100 O2'/Sugar ?
5 5 100 Watson-Crick/O2' trans y
6 6 100 Hoogsteen/O2' ?
7 8 9 Watson-Crick/Watson-Crick cis
8 11 12 Watson-Crick/Watson-Crick cis
9 12 79 Watson-Crick/O2' ?
10 13 80 Sugar/O2' ?
11 16 20 Bifurcated/O2' ?
12 17 20 C/Sugar cis y
13 19 21 Hoogsteen/O2' ?
14 19 57 Watson-Crick/Watson-Crick trans
15 19 59 Hoogsteen/Hoogsteen trans y
16 22 55 Watson-Crick/Watson-Crick cis
17 22 64 Bifurcated/O2' ?
18 24 53 Watson-Crick/Watson-Crick cis
19 24 70 Bifurcated/O2' ?
20 25 52 Watson-Crick/Watson-Crick cis
21 26 51 Watson-Crick/Watson-Crick cis y
22 27 50 Watson-Crick/Watson-Crick cis y
23 28 48 Hoogsteen/Watson-Crick trans
24 29 43 Sugar/O2' ?
25 30 39 O2'/Bifurcated ?
26 30 42 Watson-Crick/Watson-Crick cis y
27 33 36 Watson-Crick/Bifurcated cis y
28 34 35 Watson-Crick/Watson-Crick cis
29 41 43 Hoogsteen/O2' ?
30 42 43 Hoogsteen/O2' ?
31 43 48 Watson-Crick/Watson-Crick trans y
32 44 45 Watson-Crick/Watson-Crick cis
33 54 65 O2'/Bifurcated ?
34 58 72 Sugar/O2' ?
35 60 61 Watson-Crick/Watson-Crick cis
36 65 70 Watson-Crick/Watson-Crick cis
37 66 68 Hoogsteen/O2' ?
38 66 69 O2'/Bifurcated ?
39 82 90 Bifurcated/O2' ?
40 82 91 O2'/Watson-Crick ?
41 83 90 Watson-Crick/Bifurcated trans y
42 86 87 Watson-Crick/Watson-Crick cis
43 97 98 Hoogsteen/O2' ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters