Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'24-Segment pdb2vhn1B.i2317-2342 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhn:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME. (PART 2 OF 4) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (2317, 2342) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _GUGCGAAAGCAGGUCAUAGUGAUC_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
3: C2'-exo, 9: C2'-exo, 13: O4'-endo, 14: C2'-exo, 15: C2'-endo, 16: C2'-exo, 19: C4'-exo, 22: C2'-endo, 23: C2'-exo, 24: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |