Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb2vhn1B.i1908-1929 | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhn:B (&rarr PDB) | ||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME. (PART 2 OF 4) | ||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||
Position | (1908, 1929) | ||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CUAAGGUAGCGAAAUUCCUU_ | ||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C2'-exo, 6: C3'-exo, 7: C4'-exo, 10: C2'-exo, 12: C4'-exo, 13: C4'-endo, 14: C3'-exo, 15: C1'-exo, 16: C3'-exo, 17: C3'-exo, 18: C2'-exo, 20: C3'-exo, 21: C3'-exo, 22: C2'-exo | ||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
14: syn, 17: syn, 20: syn, 21: syn | ||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||
Structural Clusters |