Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'26-Segment pdb2vhm1B.i987-1014 | |||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhm:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 1 OF 4) | ||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||
Position | (987, 1014) | ||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UCCCAAAGUCAUGGUUAAGUGGGAAA_ | ||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C2'-exo, 3: C2'-exo, 6: C3'-exo, 7: C2'-exo, 8: C2'-exo, 9: C3'-exo, 10: C2'-endo, 13: C2'-exo, 16: C2'-exo, 18: C1'-exo, 19: C2'-exo, 20: C2'-endo, 21: C4'-exo, 23: C2'-endo, 24: O4'-endo, 26: C2'-exo, 27: C2'-exo | ||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
9: syn, 19: syn, 20: syn | ||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||
Structural Clusters |