Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb2vhm1B.i1908-1929 | |||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2vhm:B (&rarr PDB) | ||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF PDF BINDING HELIX IN COMPLEX WITH THE RIBOSOME (PART 1 OF 4) | ||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||
Source: Resolution | 3.74 ANGSTROMS. | ||||||||||||||||||||||||||||||||
Position | (1908, 1929) | ||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CUAAGGUAGCGAAAUUCCUU_ | ||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C2'-exo, 6: C3'-exo, 7: C4'-exo, 10: C2'-exo, 12: C4'-exo, 13: C4'-endo, 14: C3'-exo, 15: C1'-exo, 16: C4'-endo, 17: C3'-exo, 18: C2'-exo, 20: C3'-exo, 21: C3'-exo, 22: C2'-exo | ||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
14: syn, 17: syn, 20: syn | ||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||
Structural Clusters |