Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'27-Segment pdb2noq1A.i120-148 | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2noq:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF RIBOSOME-BOUND CRICKET PARALYSIS VIRUS IRES RNA | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | CRPV IRES | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 7.30 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||
Position | (120, 148) | ||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CAAUAUCCAGGAAGCCCUCUCUGCGGU_ | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |