Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2j281B.i991-1014
Source: [PDB-id:chain] 2j28:B (&rarr PDB)
Source: Information MODEL OF E. COLI SRP BOUND TO 70S RNCS
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 8.00 ANGSTROMS.
Position (991, 1014)
Primary structure ('_': anchors) _AAAGUCAUGGUUAAGUGGGAAA_
Bases with unusual sugar puckers
(Standard: C3'-endo)
2: C2'-endo, 5: C2'-endo, 6: C2'-endo, 14: C2'-endo, 16: C2'-endo, 19: C2'-endo
Bases with unusual glycosidic-bond configuration
(Standard: anti)
5: syn, 16: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 &larr
2 3 4
3 5 7
4 8 9
5 9 10
6 10 11
7 11 12
8 12 13
9 13 14
10 15 17
11 17 18
12 18 19 &larr
13 20 21
14 22 23
15 23 24
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 13 15 Watson-Crick/O2' ?
2 23 24 Bifurcated/O2' ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters