Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2j281B.i991-1014 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2j28:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | MODEL OF E. COLI SRP BOUND TO 70S RNCS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 8.00 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (991, 1014) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _AAAGUCAUGGUUAAGUGGGAAA_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
2: C2'-endo, 5: C2'-endo, 6: C2'-endo, 14: C2'-endo, 16: C2'-endo, 19: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: syn, 16: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |