Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb2j281B.i1908-1929 | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2j28:B (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||
Source: Information | MODEL OF E. COLI SRP BOUND TO 70S RNCS | ||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 8.00 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||
Position | (1908, 1929) | ||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CUAAGGUAGCGAAAUUCCUU_ | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
6: C2'-endo, 7: C4'-exo, 13: C2'-endo, 14: C2'-endo, 15: C2'-endo, 16: C3'-exo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
6: syn, 17: syn, 20: syn | ||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |