Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb2j281B.i1908-1929
Source: [PDB-id:chain] 2j28:B (&rarr PDB)
Source: Information MODEL OF E. COLI SRP BOUND TO 70S RNCS
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 8.00 ANGSTROMS.
Position (1908, 1929)
Primary structure ('_': anchors) _CUAAGGUAGCGAAAUUCCUU_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		6: C2'-endo, 7: C4'-exo, 13: C2'-endo, 14: C2'-endo, 15: C2'-endo, 16: C3'-exo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		6: syn, 17: syn, 20: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 4 5 ↑
3 8 9 ↑
4 9 10 ↑
5 10 11 ↑
6 13 17 →
7 13 22 ↑
8 14 16 &larr
9 18 19 ↑
10 19 20 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 2 6 Watson-Crick/Watson-Crick trans
2 3 5 O2'/Hoogsteen ?
3 3 6 O2'/Watson-Crick ?
4 13 20 Hoogsteen/Bifurcated cis y
5 13 22 Hoogsteen/O2' ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters