Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb2hhh1A.i995-1018 | |||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2hhh:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | CRYSTAL STRUCTURE OF KASUGAMYCIN BOUND TO THE 30S RIBOSOMAL SUBUNIT | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.35 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (995, 1018) | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _GGGUGCCCCGCGAGGGGAGCCC_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
2: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |