Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'25-Hairpin pdb2f4v1A.e399-425 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2f4v:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | 30S RIBOSOME + DESIGNER ANTIBIOTIC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.80 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (399, 425) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _GGAAGAAGCCCUUCGGGGUGUAAAC_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
1: C2'-exo, 3: C2'-exo, 5: C1'-exo, 6: C2'-endo, 7: C2'-exo, 9: C2'-exo, 13: C2'-exo, 14: C4'-exo, 15: C2'-endo, 17: C2'-exo, 18: C2'-exo, 21: C3'-exo, 22: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: syn, 15: syn, 16: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |