Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'25-Hairpin pdb2f4v1A.e399-425
Source: [PDB-id:chain] 2f4v:A (&rarr PDB)
Source: Information 30S RIBOSOME + DESIGNER ANTIBIOTIC
Source: Compound 16S RIBOSOMAL RNA
Source: Resolution 3.80 ANGSTROMS.
Position (399, 425)
Primary structure ('_': anchors) _GGAAGAAGCCCUUCGGGGUGUAAAC_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		1: C2'-exo, 3: C2'-exo, 5: C1'-exo, 6: C2'-endo, 7: C2'-exo, 9: C2'-exo, 13: C2'-exo, 14: C4'-exo, 15: C2'-endo, 17: C2'-exo, 18: C2'-exo, 21: C3'-exo, 22: C2'-endo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		5: syn, 15: syn, 16: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 2 3 ↑
3 4 6 ↑
4 7 8 ↑
5 8 9 ↑
6 9 10 ↑
7 12 13 ↑
8 17 18 ↑
9 18 19 ↑
10 19 20 ↑
11 20 21 &larr
12 21 23 →
13 23 24 ↑
14 24 25 ↑
15 25 26 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 27 Watson-Crick/Watson-Crick cis y
2 4 23 Hoogsteen/Watson-Crick trans
3 6 21 O2'/Bifurcated ?
4 7 21 Bifurcated/O2' ?
5 11 18 Watson-Crick/Watson-Crick cis
6 15 16 Watson-Crick/Bifurcated cis y
7 25 26 Bifurcated/O2' ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters