Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'28-Hairpin pdb2f4v1A.e1100-1129
Source: [PDB-id:chain] 2f4v:A (&rarr PDB)
Source: Information 30S RIBOSOME + DESIGNER ANTIBIOTIC
Source: Compound 16S RIBOSOMAL RNA
Source: Resolution 3.80 ANGSTROMS.
Position (1100, 1129)
Primary structure ('_': anchors) _AGUUGCCAGCGGUUCGGCCGGGCACUCU_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		3: C3'-exo, 4: C2'-exo, 5: C4'-exo, 7: C2'-endo, 8: C1'-exo, 13: C2'-exo, 14: C3'-exo, 15: C4'-exo, 16: C4'-exo, 18: C1'-exo, 19: C4'-exo, 20: O4'-endo, 21: C4'-exo, 23: C2'-exo, 24: C2'-exo, 28: C2'-exo, 30: C1'-exo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		17: syn, 24: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 7 18 &larr
3 9 10 ↑
4 9 25 →
5 12 13 ↑
6 12 21 →
7 22 23 ↑
8 25 26 ↑
9 26 27 ↑
10 27 28 ↑
11 28 29 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 30 Watson-Crick/Watson-Crick cis
2 3 24 Bifurcated/O2' ?
3 6 24 Watson-Crick/Bifurcated cis
4 6 26 Watson-Crick/O2' ?
5 7 9 Hoogsteen/O2' cis y
6 7 23 Bifurcated/Watson-Crick cis
7 14 19 Watson-Crick/Watson-Crick cis y
8 17 19 Bifurcated/Watson-Crick trans
9 21 22 O2'/Bifurcated ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters