Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'28-Hairpin pdb2f4v1A.e1100-1129 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 2f4v:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | 30S RIBOSOME + DESIGNER ANTIBIOTIC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.80 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (1100, 1129) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _AGUUGCCAGCGGUUCGGCCGGGCACUCU_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
3: C3'-exo, 4: C2'-exo, 5: C4'-exo, 7: C2'-endo, 8: C1'-exo, 13: C2'-exo, 14: C3'-exo, 15: C4'-exo, 16: C4'-exo, 18: C1'-exo, 19: C4'-exo, 20: O4'-endo, 21: C4'-exo, 23: C2'-exo, 24: C2'-exo, 28: C2'-exo, 30: C1'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
17: syn, 24: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |