Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'5-1-2-5-4-29-Multiloop pdb1z5812.m773-1130
Source: [PDB-id:chain] 1z58:2 (&rarr PDB)
Source: Information CRYSTAL STRUCTURE OF A COMPLEX OF THE RIBOSOME LARGE SUBUNIT WITH RAPAMYCIN
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 3.80 ANGSTROMS.
Position (774, 1129), (780, 791), (793, 879), (882, 907), (913, 922), (927, 1099)
Primary structure ('_': anchors) _GAAAU_-_A_-_GA_-_GAGAG_-_CAGA_-_AUUCAACUCGCGAAGCGAGUUGUCUGGUA_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		None
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		18: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 2 55 &larr
3 3 4 ↑
4 3 57 →
5 4 5 ↑
6 5 14 ↑
7 6 7 ↑
8 7 9 →
9 8 9 ↑
10 9 10 ↑
11 15 16 ↑
12 17 56 →
13 18 25 ↓
14 18 54 ↑
15 19 20 ↑
16 22 23 ↑
17 23 24 ↑
18 28 29 ↑
19 29 30 ↑
20 31 32 ↑
21 34 35 ↑
22 37 38 ↑
23 42 43 ↑
24 43 44 ↑
25 46 47 ↑
26 48 49 ↑
27 51 52 ↑
28 54 55 ↑
29 57 58 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 58 Watson-Crick/Watson-Crick cis
2 2 57 Hoogsteen/Sugar trans y
3 3 56 Watson-Crick/Hoogsteen trans y
4 4 11 O2'/Sugar ?
5 5 16 O2'/Bifurcated trans y
6 6 14 Hoogsteen/O2' ?
7 7 8 Watson-Crick/Watson-Crick cis
8 10 11 Watson-Crick/Watson-Crick cis y
9 14 15 Watson-Crick/Watson-Crick cis
10 15 18 Watson-Crick/O2' ?
11 15 25 Bifurcated/O2' ?
12 16 18 Bifurcated/O2' ?
13 18 19 C/O2' ?
14 19 25 O2'/Watson-Crick ?
15 20 24 O2'/Bifurcated ?
16 21 22 Watson-Crick/Watson-Crick cis y
17 26 54 O2'/Bifurcated ?
18 27 28 Watson-Crick/Watson-Crick cis
19 31 51 O2'/Watson-Crick ?
20 35 47 Watson-Crick/Watson-Crick cis y
21 36 47 Bifurcated/O2' ?
22 42 43 Hoogsteen/O2' ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters