Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'27-Segment pdb1z5812.i1319-1347 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1z58:2 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | CRYSTAL STRUCTURE OF A COMPLEX OF THE RIBOSOME LARGE SUBUNIT WITH RAPAMYCIN | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.80 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (1319, 1347) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _ACAGCAGGUCAAGAUUCCUGCACCGAU_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |