Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb1yij10.i1927-1948 | |||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1yij:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | CRYSTAL STRUCTURE OF TELITHROMYCIN BOUND TO THE G2099A MUTANT 50S RIBOSOMAL SUBUNIT OF HALOARCULA MARISMORTUI | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 2.60 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||
Position | (1927, 1948) | ||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UUAAGGUAGCGUAGUACCUU_ | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
3: C2'-endo, 6: C2'-endo, 7: C1'-exo, 9: C2'-exo, 10: C2'-exo, 13: C2'-endo, 14: C2'-endo, 15: C4'-exo, 16: C2'-endo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
6: syn, 7: syn | ||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |