Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'4-2-0-17-29-1-13-15-Multiloop pdb1y6910.m1988-2330
Source: [PDB-id:chain] 1y69:0 (&rarr PDB)
Source: Information RRF DOMAIN I IN COMPLEX WITH THE 50S RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 3.33 ANGSTROMS.
Position (1989, 2329), (1994, 2135), (2138, 2150), (2151, 2173), (2191, 2209), (2239, 2262), (2264, 2273), (2287, 2313)
Primary structure ('_': anchors) _CUUU_-_UU_-__-_GCCCAAAGGUCACCUCA_-_GUAGAGCGCAAAGGUAGAAGGUGGCUUGA_-_G_-_GGGCUUAGUGAAC_-_AUCAACGGAUAAAAG_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		14: C4'-exo, 25: C2'-exo, 27: C2'-exo, 39: C4'-exo, 40: C2'-exo, 43: C2'-exo, 47: C4'-exo, 49: C4'-exo, 50: C4'-exo, 54: C2'-exo, 60: C4'-exo, 61: C4'-exo, 69: C4'-exo, 77: C4'-exo, 85: C4'-exo, 88: C2'-exo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		36: syn, 51: syn, 77: syn, 82: syn, 90: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2 ↑
2 3 4 ↑
3 3 96 →
4 6 95 →
5 8 9 ↑
6 12 14 →
7 12 87 ↓
8 15 16 ↑
9 15 74 ↓
10 16 17 ↑
11 19 21 ↑
12 21 22 ↑
13 22 23 ↑
14 25 26 ↑
15 25 55 →
16 27 53 →
17 30 31 ↑
18 30 36 →
19 32 33 ↑
20 37 38 ↑
21 38 39 ↑
22 42 43 ↑
23 42 73 →
24 43 44 ↑
25 44 45 ↑
26 45 46 ↑
27 48 50 →
28 50 52 ↑
29 52 53 ↑
30 53 54 ↑
31 55 56 ↑
32 56 57 ↑
33 57 58 ↑
34 60 62 →
35 60 66 &larr
36 61 68 →
37 63 64 ↑
38 64 65 ↑
39 68 69 ↑
40 77 89 &larr
41 78 79 ↑
42 79 80 ↑
43 92 93 ↑
44 95 96 ↑
45 96 97 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 97 Watson-Crick/Watson-Crick cis
2 3 95 Watson-Crick/Watson-Crick cis
3 4 6 Hoogsteen/Watson-Crick cis
4 6 7 Watson-Crick/Watson-Crick cis y
5 6 94 O2'/Sugar ?
6 7 94 Watson-Crick/O2' ?
7 8 95 Hoogsteen/Watson-Crick cis
8 10 11 Watson-Crick/Watson-Crick cis
9 10 86 O2'/Bifurcated ?
10 12 13 Watson-Crick/Watson-Crick cis
11 14 87 Watson-Crick/Watson-Crick cis
12 15 40 Watson-Crick/Watson-Crick cis
13 16 69 Watson-Crick/Watson-Crick cis
14 17 20 Hoogsteen/O2' ?
15 17 68 Watson-Crick/Watson-Crick cis
16 19 59 Sugar/Hoogsteen trans y
17 20 40 O2'/Sugar ?
18 21 58 Watson-Crick/Watson-Crick cis
19 22 57 Watson-Crick/Watson-Crick cis
20 23 56 Watson-Crick/Watson-Crick cis
21 24 55 Watson-Crick/Watson-Crick cis
22 25 54 Watson-Crick/Watson-Crick cis
23 26 53 Watson-Crick/Watson-Crick cis
24 27 52 Watson-Crick/Watson-Crick cis
25 29 36 Watson-Crick/Watson-Crick cis y
26 30 33 Sugar/Hoogsteen trans y
27 30 37 O2'/Sugar ?
28 31 32 Watson-Crick/Watson-Crick cis
29 35 36 Hoogsteen/O2' ?
30 35 37 Hoogsteen/O2' ?
31 35 48 Bifurcated/O2' ?
32 36 37 Hoogsteen/O2' ?
33 39 46 Watson-Crick/Watson-Crick cis
34 41 74 Watson-Crick/Watson-Crick cis
35 44 71 Watson-Crick/Watson-Crick cis
36 47 48 Hoogsteen/O2' ?
37 50 51 C/O2' ?
38 60 64 Watson-Crick/Hoogsteen cis
39 62 63 Watson-Crick/Watson-Crick cis
40 65 66 Watson-Crick/Watson-Crick cis
41 75 76 Hoogsteen/Watson-Crick cis y
42 76 87 O2'/Bifurcated ?
43 76 89 Sugar/Sugar trans
44 79 82 Watson-Crick/Watson-Crick cis y
45 80 81 Watson-Crick/Watson-Crick cis
46 91 93 Hoogsteen/O2' ?
47 91 94 O2'/Watson-Crick ?
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters