Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb1y6910.i952-975 | |||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1y69:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||
Source: Information | RRF DOMAIN I IN COMPLEX WITH THE 50S RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS | ||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.33 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||
Position | (952, 975) | ||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UAAAUGAUCGCUCAGUGGUUAA_ | ||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
5: C2'-exo, 13: C2'-exo, 15: C2'-exo, 16: C4'-exo, 20: C2'-exo | ||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||
Structural Clusters |