Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'29-Segment pdb1y6910.i2209-2239 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1y69:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | RRF DOMAIN I IN COMPLEX WITH THE 50S RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.33 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (2209, 2239) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _GUAGAGCGCAAAGGUAGAAGGUGGCUUGA_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
8: C4'-exo, 9: C2'-exo, 12: C2'-exo, 16: C4'-exo, 18: C4'-exo, 19: C4'-exo, 23: C2'-exo, 29: C4'-exo, 30: C4'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: syn, 20: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |