Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'27-Segment pdb1xmo1A.i992-1020 | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1xmo:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||
Source: Information | CRYSTAL STRUCTURE OF MNM5U34T6A37-TRNALYSUUU COMPLEXED WITH AAG-MRNA IN THE DECODING CENTER | ||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.25 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||
Position | (992, 1020) | ||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UGGGGUGCCCCGGGGAGCCCUAGCACA_ | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
13: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
18: syn | ||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |