Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb1vqo10.i1927-1948 | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1vqo:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||
Source: Information | THE STRUCTURE OF CCPMN BOUND TO THE LARGE RIBOSOMAL SUBUNIT HALOARCULA MARISMORTUI | ||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 2.20 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||
Position | (1927, 1948) | ||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UUAAGGUAGCGUAGUACCUU_ | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
3: C2'-endo, 6: C2'-endo, 7: C1'-exo, 9: C2'-exo, 13: C2'-endo, 14: C2'-endo, 15: C4'-exo, 16: C2'-endo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
6: syn, 7: syn | ||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |