Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-5-4-3-3-7-Multiloop pdb1sm110.m775-1143
Source: [PDB-id:chain] 1sm1:0 (&rarr PDB)
Source: Information COMPLEX OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS WITH QUINUPRISTIN AND DALFOPRISTIN
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 3.42 ANGSTROMS.
Position (780, 1138), (801, 885), (891, 916), (921, 932), (936, 1108), (1112, 1130)
Primary structure ('_': anchors) _GAAAUGUAUUGAGGUACAGC_-_AGUGA_-_GAGA_-_AGA_-_AUU_-_UCUGGUA_
Bases with unusual sugar puckers
(Standard: C3'-endo)
7: C2'-exo, 42: C2'-exo, 50: C2'-exo, 51: C2'-exo
Bases with unusual glycosidic-bond configuration
(Standard: anti)
12: syn, 33: syn
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 1 2
2 2 51 &larr
3 2 54
4 3 4
5 3 53
6 4 5
7 5 29
8 6 7
9 7 8
10 8 9
11 9 10
12 15 16
13 16 17
14 17 18
15 18 19
16 19 20
17 20 21
18 22 24
19 24 25
20 25 26
21 30 31
22 33 50
23 36 37
24 41 42
25 42 43
26 46 47
27 47 48
28 50 51
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 54 Watson-Crick/Watson-Crick cis
2 2 52 O2'/Watson-Crick ?
3 3 51 Watson-Crick/O2' ?
4 3 52 Watson-Crick/Hoogsteen trans y
5 4 26 O2'/Sugar ?
6 5 31 Sugar/Hoogsteen trans y
7 6 29 Hoogsteen/O2' ?
8 7 18 Watson-Crick/Watson-Crick cis y
9 10 15 Watson-Crick/Watson-Crick cis y
10 11 12 Hoogsteen/O2' ?
11 12 15 Watson-Crick/O2' ?
12 16 27 Hoogsteen/O2' ?
13 17 27 Watson-Crick/O2' ?
14 21 25 Watson-Crick/Watson-Crick cis
15 22 23 Watson-Crick/Watson-Crick cis
16 25 53 Sugar/O2' ?
17 29 30 Watson-Crick/Watson-Crick cis
18 30 33 Watson-Crick/O2' ?
19 31 32 Bifurcated/Hoogsteen cis
20 31 33 Bifurcated/O2' ?
21 32 50 Bifurcated/O2' cis
22 33 34 C/O2' ?
23 35 36 Watson-Crick/Watson-Crick cis
24 39 50 O2'/Bifurcated ?
25 40 41 Watson-Crick/Watson-Crick cis
26 44 47 Sugar/Watson-Crick cis y
27 45 46 Watson-Crick/Watson-Crick cis y
28 51 52 Hoogsteen/Sugar cis y
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters