Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
| '22-Segment pdb1nwx10.i596-619 | |||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source: [PDB-id:chain] | 1nwx:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||
| Source: Information | COMPLEX OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS WITH ABT-773 | ||||||||||||||||||||||||||||||||||||||||
| Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||
| Source: Resolution | 3.50 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||
| Position | (596, 619) | ||||||||||||||||||||||||||||||||||||||||
| Primary structure ('_': anchors) | _GAGUCCGAAUAGGGCGGCAUUA_ | ||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual sugar puckers (Standard: C3'-endo) |
None | ||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||
| Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||
|
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||
| Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||
| 3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||||||||||
| Structural Clusters | |||||||||||||||||||||||||||||||||||||||||