Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'22-Segment pdb1nwx10.i1026-1049 | |||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1nwx:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||
Source: Information | COMPLEX OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS WITH ABT-773 | ||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.50 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||
Position | (1026, 1049) | ||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UCAAAGAGUGCGUAAUAGCUCA_ | ||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
None | ||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |