Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'0-4-22-3-6-Multiloop pdb1nkw10.m43-397
Source: [PDB-id:chain] 1nkw:0 (&rarr PDB)
Source: Information CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS
Source: Compound 23S RIBOSOMAL RNA
Source: Resolution 3.10 ANGSTROMS.
Position (44, 396), (45, 156), (161, 189), (212, 239), (243, 389)
Primary structure ('_': anchors) __-_GAAC_-_AGGAGAAGAAAGAGAAUUCGAU_-_UCA_-_UAAAUA_
Bases with unusual sugar puckers
(Standard: C3'-endo) 		5: C2'-exo, 37: C2'-exo
Bases with unusual glycosidic-bond configuration
(Standard: anti) 		None
Tertiary structure: Stacked bases
# Position 1 Position 2 Stacking direction
1 3 4 ↑
2 5 6 ↑
3 6 7 ↑
4 9 10 ↑
5 10 11 ↑
6 13 14 ↑
7 13 44 →
8 14 15 ↑
9 15 16 ↑
10 16 17 ↑
11 17 39 &larr
12 18 30 →
13 19 21 ↑
14 21 22 ↑
15 22 23 ↑
16 23 24 ↑
17 33 34 ↑
18 38 39 ↑
19 40 41 ↑
20 44 45 ↑
Tertiary structure: Base-pairs
(anchor pairs)
# Position 1 Position 2 Edges Configuration Single?
1 1 45 Watson-Crick/Watson-Crick cis
2 2 3 Watson-Crick/Watson-Crick cis
3 2 11 O2'/Bifurcated ?
4 4 12 Hoogsteen/Watson-Crick trans y
5 6 12 Watson-Crick/Watson-Crick cis y
6 6 45 O2'/Sugar ?
7 7 11 Watson-Crick/Watson-Crick cis
8 7 44 Sugar/O2' ?
9 8 9 Watson-Crick/Watson-Crick cis
10 11 13 O2'/Sugar ?
11 15 32 O2'/Bifurcated ?
12 17 30 Sugar/O2' ?
13 17 40 O2'/Bifurcated ?
14 18 38 Watson-Crick/Hoogsteen trans y
15 21 28 Watson-Crick/Watson-Crick cis
16 25 27 O2'/Bifurcated ?
17 31 42 Watson-Crick/Watson-Crick trans y
18 32 33 Watson-Crick/Watson-Crick cis
19 33 42 Sugar/Bifurcated cis y
20 36 39 O2'/Watson-Crick ?
21 36 40 Hoogsteen/Hoogsteen trans y
22 37 38 Watson-Crick/Watson-Crick cis
Downloads Atom coordinates (PDB format)
Contact annotation (MC-Annotate format)
3D Structure Structure Graph
Structural Clusters