Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'23-Segment pdb1nkw10.i951-975 | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1nkw:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||
Source: Information | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS | ||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.10 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||
Position | (951, 975) | ||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _CUAAAUGAUCGCUCAGUGGUUAA_ | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
14: C2'-exo, 21: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
None | ||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |