Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
| '22-Segment pdb1nkw10.i1026-1049 | |||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source: [PDB-id:chain] | 1nkw:0 (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||
| Source: Information | CRYSTAL STRUCTURE OF THE LARGE RIBOSOMAL SUBUNIT FROM DEINOCOCCUS RADIODURANS | ||||||||||||||||||||||||||||||||||||||||||
| Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||
| Source: Resolution | 3.10 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||
| Position | (1026, 1049) | ||||||||||||||||||||||||||||||||||||||||||
| Primary structure ('_': anchors) | _UCAAAGAGUGCGUAAUAGCUCA_ | ||||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual sugar puckers (Standard: C3'-endo) |
8: C4'-exo | ||||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual glycosidic-bond configuration (Standard: anti) |
None | ||||||||||||||||||||||||||||||||||||||||||
| Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||
|
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||
| Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||
| 3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||||||||||||
| Structural Clusters | |||||||||||||||||||||||||||||||||||||||||||