Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
'20-Segment pdb1n8r1A.i1927-1948 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Source: [PDB-id:chain] | 1n8r:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Information | STRUCTURE OF LARGE RIBOSOMAL SUBUNIT IN COMPLEX WITH VIRGINIAMYCIN M | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Compound | 23S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Source: Resolution | 3.00 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Position | (1927, 1948) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Primary structure ('_': anchors) | _UUAAGGUAGCGUAGUACCUU_ | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual sugar puckers (Standard: C3'-endo) |
3: C2'-endo, 6: C2'-endo, 7: C2'-endo, 9: C2'-exo, 13: C2'-endo, 14: C2'-endo, 15: O4'-endo, 16: C2'-endo, 17: C2'-endo, 20: C2'-endo, 21: C2'-endo | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Bases with unusual glycosidic-bond configuration (Standard: anti) |
6: syn, 7: syn | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||
3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||||||||
![]() |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||
Structural Clusters |