Please cite:
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
Schudoma et al.,
Nucl. Acids Res. 38: 970-980.
DOI 10.1093/nar/gkp1010.
| '24-Segment pdb1fka1A.i1003-1028 | |||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Source: [PDB-id:chain] | 1fka:A (&rarr PDB) | ||||||||||||||||||||||||||||||||||||||||||||||||
| Source: Information | STRUCTURE OF FUNCTIONALLY ACTIVATED SMALL RIBOSOMAL SUBUNIT AT 3.3 A RESOLUTION | ||||||||||||||||||||||||||||||||||||||||||||||||
| Source: Compound | 16S RIBOSOMAL RNA | ||||||||||||||||||||||||||||||||||||||||||||||||
| Source: Resolution | 3.30 ANGSTROMS. | ||||||||||||||||||||||||||||||||||||||||||||||||
| Position | (1003, 1028) | ||||||||||||||||||||||||||||||||||||||||||||||||
| Primary structure ('_': anchors) | _AGCACAGGUGCUGGGCCGUCGUCA_ | ||||||||||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual sugar puckers (Standard: C3'-endo) |
24: C4'-exo, 25: C2'-exo | ||||||||||||||||||||||||||||||||||||||||||||||||
|
Bases with unusual glycosidic-bond configuration (Standard: anti) |
5: unknown, 10: unknown, 14: unknown, 15: unknown, 16: unknown, 23: unknown, 24: unknown, 25: unknown | ||||||||||||||||||||||||||||||||||||||||||||||||
| Tertiary structure: Stacked bases |
|
||||||||||||||||||||||||||||||||||||||||||||||||
|
Tertiary structure: Base-pairs (anchor pairs) |
|
||||||||||||||||||||||||||||||||||||||||||||||||
| Downloads |
Atom coordinates (PDB format) Contact annotation (MC-Annotate format) |
||||||||||||||||||||||||||||||||||||||||||||||||
| 3D Structure | Structure Graph | ||||||||||||||||||||||||||||||||||||||||||||||||
|
|||||||||||||||||||||||||||||||||||||||||||||||||
| Structural Clusters | |||||||||||||||||||||||||||||||||||||||||||||||||